Dragoneticist by Gidaio
Yeah. This is the first game we've ever done as a team, and it's VERY rough. BUT IT'S AWESOME THAT WE DID THIS, EVEN IF IT SUCKS.
Yeah. Have fun, and remember that there may or may not be more to come.
Arrow keys to move.
Also, Windows only, because we don't have GM Studio and we only have PCs. So yeah, sorry.
-----
Story
-----
You are a geneticist who is tired of the fact that the real world doesn't have dragons in it. So you set up a lab and start manufacturing the dragons! As you walk in to your lab one day, you notice that all of your work was stolen! Now you must go find out who did it, and beat them into submission with your own custom-made dragon, editing through tampering with the genetic code.
Yeah. Have fun, and remember that there may or may not be more to come.
Arrow keys to move.
Also, Windows only, because we don't have GM Studio and we only have PCs. So yeah, sorry.
-----
Story
-----
You are a geneticist who is tired of the fact that the real world doesn't have dragons in it. So you set up a lab and start manufacturing the dragons! As you walk in to your lab one day, you notice that all of your work was stolen! Now you must go find out who did it, and beat them into submission with your own custom-made dragon, editing through tampering with the genetic code.
| Windows | http://dl.dropbox.com/u/100108960/dragoneticist.exe |
| Original URL | https://ludumdare.com/compo/ludum-dare-24/?action=preview&uid=14818 |
Ratings
| Coolness | 69% | 3 |
| Overall(Jam) | 3.12 | 120 |
| Audio(Jam) | 1.53 | 204 |
| Fun(Jam) | 2.88 | 130 |
| Graphics(Jam) | 2.44 | 217 |
| Humor(Jam) | 3.04 | 57 |
| Innovation(Jam) | 3.50 | 38 |
| Mood(Jam) | 2.50 | 169 |
| Theme(Jam) | 3.59 | 34 |
it would help if the discovered combinations would show up at the dna screen and the characters should be right above every base, because it's hard to see which base I am modifying if I have to look to the top like it is now
I like the idea how you modify your dragon trough the DNA structure. I really want to see this become a finished game(more content better graphics, animations,more customization)
Also what is the difference between the 3 types of attack?
Overall a good game!
@Kayelgee That was the original plan. Actually, the original plan was to have the characters show you the DNA sequences in a color format, so it would be easy and intuitive. Unfortunately, as is extremely common, we ran out of time... :/
I just ran through the whole game with the basic dragon. When I fought the final dragon, it immediately jumped so high it went off-screen and died, leaving me the victor. Hilarious as that may have been, I'm sure that wasn't intentional.
It was a cool idea, though. Good effort, but better luck next time!
It will be nicer if it has a tutorial and maybe a book to save the DNA combinations. It was difficult to figure out most of the stuff in the beginning.
There was a bug with the last boss, it just flew away and all of a sudden I won LOL
PS : I found a bug! If you move sideways getting out of a room, you end up behind in the dark area! ;)
Got beaten down twice by THE ULTIMATE DRAGON though. Nice work!
If anyone wants the best string I came up with, it is this:
agggacttagctaggtttaaatgcgaacctaatcat
I can't tell if there are any more useful strands or not.
Also, yeah, kind of annoying entering them manually. Maybe with a keyboard, or clipboard function?
Anyway, nicely done.